ProteoCool Pills #32: HemA, a powerfull selection marker for antibiotic free plasmid mantainance for recombinant protein expression in E.coli

Antibiotic resistance genes  (e.g Ampicillin, Kanamycin) are the most commonly used markers for plamisd selection in DNA production and recombinant protein expression processes. 

Adding an antibiotic resistance gene to the plasmid solves 2 problems at once:  It allows a scientist to easily select the plasmid-containing bacteria when the cells are grown on selective media and at the same time provides those bacteria with a pressure to keep your plasmid.

For the reason the most of commercial vectors suitable for recombinant protein expression in E.coli  as pET,  pQE, pMal, pCold, pGEx carry Ampicillin, Kanamicin selection marker. . 

Even if this strategy work very well in R&D setting, on the contrary it has several drawbacks for biological manufacturing. 

The spreading of antibiotics in the environment and consequent emergence of multi-resistant pathogenic bacterial strains has become a general promise to even further increasome categories of biological products such as DNA vaccines where potential issue of allergic reesponses to some classes of antibiotics is evoked and the necessity to document the trace amount of antibiotics. 

Apart from the use of the antibiotic itself, there is another emerging limitation in the use the antibiotic resistance gene used as a selection marker due to the potential risk of horizontal transfer of antibiotic resistance gene to environmental microbes

Behind the regulatory issues, the use of antibiotic resistance gene marker imposes a significant metabolic burden on the cells and may. also impact the process yield. 

At least but not last,antibiotics themselves are expemsive and therefore often omitted in fermentations, leading to plasmid loss and a corresponding loss in product yield. 

In this context novel strategies to efficiently replace antibiotic-based selection are required. 

To date, several systems have been developed based on different principles, each presenting advantages and drawbacks. 

The most common way to achieve selection in the absence of antibiotics is the complementation of an essential gene making use of an expression vector in a strain with a defect or inhibited expression of the same essential gene.

Several examples are reported in literature where the plasmid selection is achieved through the complementation of amino acid auxotrophy (e,g Proline;  Glycine)  and more recently of QAPRTase, an enzyme implied in de novo nicotinamide adenine dinucleotide biosynthesis. 

Many different E.coli auxothopic strains were already generated but to ensure the proper selective pressure, the auxotrophy complementation systems reported so far require the use of chemically defined media since the standard complex media contain variable amounts of aminoacids as well as other catabolites that covercome the need of biosynthetic pathway and as a consequence the loss of selective pressure for the complementation plasmid maintenance.

About 10 years ago I was involved in a project aimed to developed a novel antibiotic free plasmid selection approach for protein selection in E.coli. 

Some experiences gained in previous work activities such as: 

1) The positive effect that the supplementation  δ-ALA (δ-aminolevulinic acid) has on recombinant Human cyt c expression in E.coli (CERM)

2) The use of 5-aminolevulinic acid (ALA) as  a prodrug to stimulate  intracellular Heme biosynthesis to produce the natural photosensitizer (PS) Protoporphyrin IX (PpIX) in antimicrobial photodinamic therapy (Molteni Therapeutics)

lead me tot think that the complementation of hemA deficient bacteria by a vector carrying a functional hemA gene, as a selection marker, which confers to the transformed bacteria the ability to grow and maintain the vector in any medium that does not support growth of hemA deficient bacteria of a mutation in heme biosynthetic pathway and at the same time the complementation of empty cells with 5-ALA allow to easly propagate and prepare the empty competent cells.

After several months of work we produced an interesting data package supporting our hipotesis and a patent application was filled and submitted (WO2015165841 - AN ANTIBIOTIC-FREE METHOD FOR SELECTWO2015165841 - AN ANTIBIOTIC-FREE METHOD FOR SELECTION OF TRANSFORMED BACTERIA)

Even if the patent was not accepted since the examing authority do not recognize its inventive steps since the HemA was already show to work as selectable marker in Aspergillus Oryzae, i still think that it is work very well in E.coli since we was able to show that the Delta HemA E.coli  show negligible growth in both chemical defined and complex media but the growth it readly restored when there are complemented with 5-ala or plasmid carryng (see Fig2a,2b and Fig3a,3b of the WO2015165841 patent application)   the HemA gene and that the expression was mantained after a several different passages.

E. coli BL21(DE3) DeltaHemA/pet21-BFP and E. coli BL21(DE3)/pet21-BFP were cultivated without antibiotic selection for many generations by diluting a 12h culture 1:100 in fresh medium for several times. After 1,2,5,10,15 passages the recombinant protein expression was analyzed (1G ≈ 7-8 duplications) and as reported in the Fig5 of the WO2015165841 patent apprication,  the BFP production in HemA mutant strain complemented with BFPpet24-HemA is stable after 15 cultivation cycles without antibiotic while in the wild type strain transformed with standard BFPpet24, it dramatically decreases after 5 cultivation cycles without selection.     

 I would like to Thanks to

Maria Giuliani

that performed the most of the experimental work

and provide an essential contribute in experiment desing 

 

ProteoCool Pills#28: Extracellular vesicle production using ExpiCHO

 In the last 10 years the genetic engineering of bacteria as well as mammalian cell lines allow to design and produce extracellular vesicles decorated with specific protein antigens that can be used as vaccine Outer membrane vesicles (OMVs) are released spontaneously during growth by many Gram-negative bacteria. candidates, as immnunogen for the production of monoclonal antibodies for those antigens (eg intregral membrane proteins) that are difficult to produce in soluble recombinant forms.

Extracellular vesicles are released spontaneously during growth of Gram-negative bacteria as well as mammalian cell lines (eg. HEK293).

For some applications wild-type strains can be used directly to produce an extracellular vesicle but, in most cases, genetic engineering of the expression Host is required not only to induce the over-expression of specific single on multiple antigens but also to improve vesicles productivity and safety.

In gram-negative bacteria several genetic modifications able to improve vesicles production (eg.  TolR, OmpA deleted strain) as well as modifying the synthesis of a LPS carrying (e.g msbB, pagP and other mutants) and reduce vesicle reactogenicity were already identified and tested.

Therefore, even if the mammalian extracellular vesicles (e.g exosomes) have been more extensively studied than bacterial extracellular vesicles, one of the challenges the limit the use of mammalian vesicles as scaffold for antigen expression is their low production yield.

Therefore, similarly to what happened 20 years ago at the beginning of recombinant protein expression age, the Bacteria thanks to their rapid proliferative abilities, process scalability of their culture methods and gene editing ability has been more extensively applied for extracellular vesicle production.

However, in the last 20 years several new technological improvements as:

 1) The adaptation of several cell lines to suspension cultures;

 2) The development of more efficient transfection agents and new gene editing technologies:

 3) The development of serum free media where the cells are able to growth at high cell density;

 

Improve drastically the performances of the mammalian expression systems and make it not only very interesting as platform for production of recombinant soluble proteins but also as factory of engineered extracellular vesicles.

Chinese hamster ovary (CHO) cells are widely used host cells for recombinant protein production and currently the most commonly utilized mammalian organism in large scale bio-pharmaceutical production and some recent papers (1,2) report their ability to produce extracellular vesicles.

As I already show you in the ProteoCool Pill#8  the ExpiCHO cell line is a CHO derivate that thanks to its ability to growth very high cell density (8-10 milion cells/ml) and high transfection efficiency result in high yields of recombinant antibody and protein production.

In this post I would like to briefly share with you some preliminary result that suggest as ExpiCHO may become also a promising platform for production of engineered extracellular vesicles. I would like to point out as the fact that ExpiCHO growth very well in serum free media is essential for production of engineered extracellular vesicles since the serum contain a large amout of  unwanted empty vesiscles that may contaminate our preparation and vesicle serum depletion is time consuming and difficult to scale up. 

This trials were performed by comparing the extracellular production ability of commercial ExpiCHO empty cells with an antigen over expressing Expo-CHO cell line derivate that was generated  (data not shown) using the Flp-In cloning system. 

Since Expi-CHO Flp-In cell line are not commercially available, first of all, an ExpiCHO Flp-In cell line was generated by transfection of ExpiCHO with pFRT/lacZeo vector and the positive clone were  isolated after growth under Zeocin selection. 

Afterwards the GPCR expressing ExpiCHO cell line was generated by co-tranfection of GPCR-pcdna5/FRT and pOG44 vectors and the positive clone were isolated after growth under Hygromicyn selection.  

 

                                                     1° Vesicles production trial:   

                Comparison of 2 different growing protocols for the the empty ExpiCHO cell line.

                           

                                                             Protocol Overview

After re-suspension with PBS the Vesicles were subjected to  SDS-page and Nanotracking particle analisys (Nanosight- Malvern)

Even if the NTA results do reveal important differences between the vesicles produced at 37°C and 32°C, the presence of the strong yellow colour (which suggest the presence of some contaminant) as well us the partial resuspension at 32°C lead us to prefer the condition n°1.

                                                          2° Vesicles production trial:   

                Vesicle production with condition 1 using empty and GPCR expression ExpiCHO

                           

Even it those results are really preliminary, the fact that extracellular vesicle expressing a GPCR could be successfully isolated in good amount (about 10^10 vesicles/liter) suggest that ExpiCHO may represent a promising platform for production of engineered extracellular vesicle suitable as vaccine component or immunogen for the production of new monoclonal antibodies targeting specific transmembrane antigens. 

ProteoCool Pills#19: Pay attention to reverse GOI insertion in TOPO cloning

The TOPO cloning technology (compared with PIPE and standard cloning in ProteoCool n° 1 is a simply and fast cloning approach able to accommodate a wide range of PCR insert sizes.

TOPO technology enables inserts with compatible ends to be readily joined to the vector in 5 minutes, without the need for additional ligation steps.

In my experience in some cases, incorrect Gene insertion (reverse) may happen in a certain %  (in my expereince 40-50%) of the E.coli clones obtained from TOPO reaction: 

This problem could be generally overcame just by screening and sequencing a large number of colonies (at least 4-6 for each clone)

However is important to pay attention to it during the PCR colony screening and the following sequence check:

For example, PCR colony screening  (see ProteoCool n° 4 for more detail about it)  performed with primers those anneal in the vector backborne will be not able to differenziate clones with reverse insertion from the good ones. 

Since the regions of the TOPO vectors located around (just before and after) the GOI insertion sites are quite similar (especially in the case that the GOI is cloned in a plasmid that do not codify for any C- or N- terminal tag)  is possible that the reverse insertion cpuld be not revealed by a not expert users. 

Example of cloning of a C-terminal His-tagger GOI in pcdna 3.4 TOPO for recombinant protein expression in mammalian cells (eg Expi293 or ExpiCHO)

In this case primers in addition to the GOI annealing sequence have to contain a flag carryng:

- KOZAC sequence before ATG start codon (Forward primer); 

- codons codyfing for the His tag followed by 1 or 2 Stop codons;

The final expected sequence (in the GOI is inserted in the correct direction) will be:

 TGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGGACTCTAGAGGATCGAACCCTTgccaccATG-GOI-HIStag-STOP -STOP -AAGGGTTCGATCCCTACCGGTTAGTAATGAGTTTGATATCTCGACAATCAACCTCTGG

In yellow --> The region of pcdna3.4 before the insertion,

In Green --> The region of pcdna 3.4 after the insertion; 

and the respective Aminoacid traslation will be:

DLHRRHRDRSSLRTLEDRTLATM-GOI-HisTag**KGSIPTG***V*YLDNQPL 

 where * indicates STOP CODONS

On the contrary in case that the GOI is inserted in the opposite direction the final sequence will be:

ATTTTGTAATCCAGAGGTTGATTGTCGAGATATCAAACTCATTACTAACCGGTAGGGATCGAACCCTTgccaccATG-GOI-HIStag-STOP-STOP-GGGAGGGGGAAAGCGAAAGTCCCGGAAAGGAGCTGACAGGTGGTGGCAATGCCC

and the respective Aminoacid traslation will be:

FVIQRLIVEISNSLLTGRDRTLATM-GOI-HISTag**KGSIL*SPEAGSVPVSSMEVKTAWM

Performing an allingment you can easly see how the insert flanking regions are really similar

therefore during the sequence check, the sequence analisys cannot be restricted to the few bases close to the insert but need to be extended at least to 10-20bp before and 15-20bp after the insert. 

The risk of this kind of mistake is higher in vectors as pcdna3.4 those do not codify for any additional N- or C-terminal tag. In a vector those codify for a TAG, in case of reverse PCR insertion, you will found the  AA sequence of the TAG traslated in the opposite direction respect than the sequence of the insert.

In case you have some clone produced using TOPO cloning and do not show any expression,, i suggest to you,  before re-design the cloning strategy, to perform a double sequence check to be sure that your gene was inserted in the correct direction.